Another factor that may have played a role in the current investi

Another factor that may have played a role in the current investigation is

the type of protein consumed in the high protein group. Because of the difficulty in consuming 4.4 grams of protein per kg body weight daily, every subject in the high protein group acquired their additional protein calories primarily from whey protein powder. It has been shown that the thermic effect is greater with whey versus TGF-beta Smad signaling casein or soy protein [39]. Recently scientists demonstrated that consuming similar calories and protein during resistance training in initially untrained individuals resulted in greater gains in lean body mass in the whey supplemented group versus soy or carbohydrate [40]. Another investigation found that muscle protein synthesis after whey consumption was check details approximately Chk inhibitor 93% greater than casein and approximately 18% greater than soy. Furthermore, the same pattern held when measured post-exercise (whey > soy > casein) [41]. On the other hand, 48 grams of both whey and rice protein isolate consumed post resistance exercise improved indices of body composition and exercise performance similarly [42]. Thus, one might speculate

that if the protein dose or intake is sufficiently high, it may not matter what that particular protein source may be. Conclusion This is the Tangeritin first investigation in resistance-trained individuals which demonstrates that a hypercaloric high protein diet does not contribute to a fat mass gain. Furthermore, there was no change in body weight or lean body mass. This is in contrast with other overfeeding studies which showed gains in body weight, fat mass and

lean body mass; however, those investigations were performed in non exercise-trained individuals that were consuming a lower protein diet (in comparison to our study). It should be noted that the subjects in the current study did not alter their training. It would be intriguing to ascertain if a high protein diet concurrent with a heavy resistance bodybuilding training regimen would affect body composition (i.e. increase lean body mass and lower fat mass). We did not measure blood indices to determine if any side effects (i.e. renal or hepatic function) occurred in the high protein group. A few subjects did complain of gastrointestinal distress as well as feeling ‘hot’ (i.e. their body temperature was chronically elevated). Future research should focus on trained subjects using a single source of protein during overfeeding. Furthermore, a heavy resistance program geared towards skeletal muscle hypertrophy in conjunction with protein overfeeding needs further investigation. Acknowledgement We would like to thank Dr.

The genes encoding these proteins are located in RD2, a genomic r

The genes encoding these proteins are located in RD2, a genomic region deleted in a number of more recent BCG strains, including M. bovis BCG Pasteur, but present in BCG Moreau [6, 7]. The low levels of MPB70 and MPB83 in M. bovis BCG Pasteur were also confirmed find more in our study. Their reduced expression is due to a point mutation in the translational start codon of the sigK gene [67], observed in many BCG strains, but absent in BCG Moreau. Immunologic studies have shown that both proteins induce cellular and humoral immune responses

in experimental models of infection and in natural infection in humans [68, 69]. MPB63 is a protein only found in species within the Mtb complex [70], mTOR inhibitor cancer shown to be immunodominant both in humans and animal models [71] and a promising candidate for serodiagnosis of active TB as well as for vaccine development. MPB63 was identified in four different spots (109,111,112 and 160), 2 of which (111 and 160) showed statistically significant differences in expression, with an increase of more than 3-fold in BCG Moreau

as compared to BCG Pasteur (Table 1 and Figure 5). These 4 protein spots are likely to represent isoforms, probably differing due to the presence of PTMs, known to cause changes in pI resulting in slightly different migration. Moreover, MPB63 contains an N-terminal signal sequence as predicted by the SignalP software, which was experimentally verified [72]. The alanine-proline rich protein (Apa, Rv1860, BCG1896, spots 11, 12, 13 and 14) is known to present a high content of proline and carbohydrate

groups [37] that interferes with its migratory behavior in SDS-PAGE. Although we have not identified modifications such as glycosylation, Carbohydrate this protein displays a characteristic four-spot pattern (doublet of 2 horizontally dispersed spots) on 2DE [39] (Additional file 5, Figure S2). The isoforms of lowest molecular mass (spots 13 and 14) showed a statistically significant 3-fold increase in expression in BCG Moreau (Table 1 and Figure 5). This protein seems to be restricted to the Mtb complex and has been shown to be a target for immune recognition in animals immunized with live BCG [73]. In addition to its high immunogenicity, it has also been described as a potential adhesin involved in the colonization of target cells [39]. Its higher expression could contribute to an increase in the immunogenicity of BCG Moreau. Four proteins were found to be at least 2-fold more expressed in BCG Pasteur compared to Moreau: a peptidyl-prolyl cis-trans selleck chemicals isomerase (PPIaseA, Rv0009, BCG0009), the trigger factor (TF, Rv2462c, BCG2482c), Hsp65 (GroEL2, Rv0440, BCG0479) and Hsp70 (DnaK, Rv0350, BCG0389), all described as participating in protein folding and response to stress, among other functions.

Appropriate DNA fragments of leptin gene -18G > A, leptin recepto

Appropriate DNA fragments of leptin gene -18G > A, leptin receptor gene K109R and Q223R were amplified using PCR and analyzed using PCR-RFLP (Restriction Fragments Length Polymorphism), DHPLC (Denaturing High Performance Liquid Chromatography) or direct sequencing. The primer sequences are shown in table 2. Table 2 Sequences of primers Genetic polymorphism Sequences of primers Genotyping method used (restriction enzyme) Leptin gene – 18G > A tggagccccgtaggaatcgca tgggtctgacagtctcccaggga PCR-RFLP (AciI) Leptin receptor gene

– K109R tttccactgttgctttcgga aaactaaagaatttactgttgaaacaaatggc PCR-RFLP (HaeIII) Leptin receptor gene – Q223R aaactcaacgacactctcctt tgaactgacattagaggtgac PCR-RFLP (MspI) Statistical analysis The correlations of the genetic polymorphisms, biochemical test results, and overweight status were analyzed with regard to gender, GDC-0449 solubility dmso intensity of chemotherapy (high intensity vs. standard intensity regimens) and to the use of CRT. Results selleck chemicals llc were expressed as mean ± SEM. The data were analyzed by ANOVA followed by Scheffe’s post hoc test. For between-group comparison of nonparametric variables Chi2 test was used. Correlations between the variables were calculated using Pearson correlation. The P values < 0.05 were considered statistically significant.

selleck kinase inhibitor The statistical analyses were performed using the Statistica 8 software package (Stat Soft, Inc., USA). Permanent Ethical Committee for Clinical Studies of the Medical College of the Jagiellonian University approved the study protocol. All parents, adolescent patients and adult patients signed written informed consent before blood sample collection. No patient refused participation in the study. Results Anthropometric evaluation Median BMI percentiles at the time cAMP of ALL diagnosis and at the time of the study were 45.3 (m:0; M:99.6) and 65.5 (m:0.3; M:99.6), respectively. After the completion of ALL treatment BMI ≤ 10 percentile and ≥ 95 percentile was found in 9% and 13% of patients, respectively. At ALL diagnosis 21% of patients were classified as overweight (BMI ≥ 85), the respective proportion

at the time of the present study was 31%. The prevalence of the overweight status at the time of ALL diagnosis/after ALL treatment in patients treated with and without CRT was 10%/23% and 20%/35%, respectively (table 3). Table 3 Anthropometric evaluation Patients Total CRT No CRT   Number of patients (%) Total 82 (100) 31 (38) 51 (62) Gender:       Female 37 (45) 16 (20) 21 (26) Male 45 (55) 15 (18) 30 (36) Overweight at ALL diagnosis 13 (16) 3 (10) 10 (20) Overweight after ALL treatment 25 (31) 7 (23) 18 (35) CRT – cranial radiotherapy Leptin and soluble leptin receptor Significant differences were found between leptin levels in patients treated with and without CRT (figure 1) both in the entire study population (22.2+/- 3.13 ng/ml vs. 14.9+/-1.6 ng/ml; p < 0.03) and in female patients (29.9+/-4.86ng/ml vs. 16.9+/-2.44 ng/ml; p = 0.014).

Infect Immun 2004,72(9):5143–5149 PubMedCrossRef 64 Hense BA, Ku

Infect Immun 2004,72(9):5143–5149.PubMedCrossRef 64. Hense BA, Kuttler C, Muller J, Rothballer M, Hartmann A, Sapitinib cost Kreft JU: Does efficiency sensing unify diffusion and quorum sensing? Nat Rev Microbiol 2007,5(3):230–239.PubMedCrossRef Authors’ contributions JNW conceived, designed and performed the experiments, and drafted the manuscript. CLG performed computational analyses and assisted in drafting the manuscript. KLD performed computational analyses, contributed to manuscript development and critically revised the manuscript. HRG helped to

analyze the data and critically revised the manuscript. LGA contributed to the data acquisition and critically revised the manuscript. TAF conceived and coordinated the study and helped to draft the manuscript. All authors read and approved the final manuscript.”
“Background RNA polymerase holoenzyme, consisting of a 5-subunit core RNA polymerase (α2ββ’ω) and a dissociable subunit, sigma (σ), initiates bacterial transcription. The σ factor contains selleck compound many of the promoter recognition determinants and several σ factors each recognizing their specific class of promoter sequences have been described [1–5]. In general, in exponentially growing bacteria Quisinostat chemical structure transcription is initiated by RNA polymerase carrying the housekeeping σ, known as σ70 [6]. Alternative σ factors mediate transcription of regulons activated

under specific environmental conditions [7, 8]. The activity of many alternative σs is inhibited by a specific anti-σ factor. In a wide variety of bacterial species the σ factor

σE,, also known as extracytoplasmic isothipendyl factor or ECF, belonging to the group IV σs, is essential in mounting responses to environmental challenges such as oxidative stress, heat shock, and misfolding of membrane proteins [9, 10]. In addition, σE is of importance for virulence of bacterial pathogens [11–22]. The regulon size of σE varies widely among bacterial species studied, ranging from 89 unique σE controlled transcription units in E. coli and related bacteria [23] to a relatively small regulon of 5 genes in Neisseria gonorrhoeae [24]. In most examples, the gene encoding σE (rpoE) is located in an autoregulated operon that also contains, directly downstream of rpoE, the gene encoding its cognate anti-σE factor [25–28]. Extensive sequence analysis showed that about one third (1265/˜3600) of known and predicted anti-group IV σ factors, encoded in a gene cluster with a group IV σ (with only one exception), contain a conserved structural N-terminal fold, recently described as the anti-sigma domain (ASD) [26]. Typically, the ASD is in the N-terminus, oriented towards the cytoplasm, preceding a C-terminal transmembrane segment. However, 20% of the 1265 ASD containing proteins are not predicted to contain a transmembrane spanning C-terminal domain [26].

In addition, TaN has been used in high-temperature ceramic pressu

In addition, TaN has been used in high-temperature ceramic pressure sensors because of its good piezoresistive properties [3]. Also, it is an attractive histocompatible material that can be used in artificial heart valves [4]. Among the various tantalum nitride phases, cubic delta-tantalum nitride (δ-TaN), with a NaCl-type structure (space group: Fm3m), exhibits excellent properties selleck chemicals such as high hardness, stability at high temperature,

and superconductivity [5]. In general, it is difficult to produce δ-TaN under ambient conditions since its formation requires high temperature and nitrogen pressure. According to the data reported in another study [6], δ-TaN is ATM/ATR mutation normally made at more than 1,600°C and 16 MPa of nitrogen pressure. Kieffer et al. synthesized cubic TaN by heating hexagonal TaN above 1,700°C at a N2 pressure of 6 atm [7]. Matsumoto and Konuma were successful in producing cubic TaN by heating

hexagonal TaN at a reduced pressure using a plasma jet [8]. Mashimo et al. were able to transform hexagonal TaN into cubic TaN by both static compression and shock compression at high temperature [9]. Cubic TaN in powder form was also synthesized by self-propagating high-temperature synthesis technique [10, 11]. In this process, the combustion of metallic tantalum from 350 to 400 MPa of nitrogen pressure resulted in micrometer size δ-TaN at a temperature above 2,000°C. More recently, two approaches, solid-state metathesis reaction and nitridation-thermal

decomposition [12–14], were adopted for the synthesis of nanosized particles of δ-TaN. O’Loughlin et al. used the metathesis reaction of TaCl5 with Li3N and 12 mol of NaN3 to produce δ-TaN [12]. The authors concluded that significant nitrogen pressure created by the addition of NaN3 enabled cubic-phase Chlormezanone TaN to form, along with hexagonal Ta2N. Solid-state metathesis reaction applied to the TaCl5-Na-NH4Cl mixture resulted in a bi-phase product at 650°C comprising both hexagonal and cubic phases of TaN [13]. More recently, Liu et al. reported the synthesis of cubic δ-TaN through homogenous reduction of TaCl5 with sodium in liquid ammonia, with a subsequent annealing process at 1,200°C to 1,400°C under high vacuum [14]. Nitridation-thermal decomposition, a two-step process for the synthesis of cubic δ-TaN, was also reported [15]. In the first step, nanosized Ta2O5 was selleck inhibitor nitrided at 800°C for 8 h under an ammonia flow. The as-prepared product was then thermally decomposed at 1,000°C in nitrogen atmosphere, and cubic nanocrystalline δ-TaN was obtained. In most cases, the products prepared by the above-mentioned methods were often mixtures containing other compounds such as TaN0.5 or other nonstoichiometric phases.

[47], Vibrio cholerae [24] and Pseudomonas stutzeri [25] Both ML

[47], Vibrio cholerae [24] and Pseudomonas stutzeri [25]. Both MLEE and MLRT showed European strains WH-4-023 in vitro to be more heterogeneous than the Indian strains. MLEE revealed that each of the 15 strains from France and Germany had Autophagy Compound Library nmr distinct electrophoretic profiles indicating their heterogeneity.

MLRT also revealed that the European strains, which displayed 5 RTs were more heterogeneous compared to Indian isolates. Genetic heterogeneity of European biovar 1A strains has been reported earlier using PFGE [48] and FAFLP [39]. A previous study using multilocus variable number tandem repeat analysis also identified 13 MLVA types among 15 European biovar

1A strains [19]. This suggests that European and Indian strains may constitute separate groups and might be evolving independently in two different settings. It would be interesting to explore these evolutionary aspects by comparative whole genome sequencing or multilocus sequence typing of Indian and European strains. It was also observed that strains with different serotypes (O antigen) types produced identical ETs or RTs PCI-34051 solubility dmso and were closely related genetically. Also, in some cases, same O antigen was shared by strains that were different genotypically. These observations indicate O antigen switching in strains of Y. enterocolitica as suggested recently by MLST [49]. Such observations have however been reported in other bacteria also [24, 41, 50]. Thus, given the enormous discriminatory power of genotyping techniques such observations also emphasize the need to discuss threadbare, the question of suitability of widely used typing techniques like serotyping. Conclusion More diversity was observed among clinical and non-clinical strains of Y. enterocolitica biovar 1A when MLEE was used. Sixty-two electrophoretic types were identified among 81 strains,

which clustered into four distinct groups. STK38 MLRT identified 12 restriction types and was distinctly less discriminatory, clustering the strains into two groups. The BURST analysis of the MLRT data nevertheless provided newer insights into the probable evolution of clinical strains from those present in the aquatic environments. Acknowledgements SM acknowledges Senior Research Fellowship from Council for Scientific and Industrial Research, New Delhi, India. The research grants to JSV from Department of Biotechnology, Indian Council of Medical Research and University of Delhi to strengthen R & D doctoral research programme are acknowledged gratefully. Electronic supplementary material Additional file 1: Representative restriction profiles of six genes of Y. enterocolitica biovar 1A.

X-ray diffraction (XRD; M18XHF-SRA, Mac

X-ray diffraction (XRD; M18XHF-SRA, Mac Science, Tokyo, Japan) was employed to analyze the crystal structure of the ZnO electrodes, and field emission scanning electron microscopy (FE-SEM; SU70, Hitachi, Tokyo, Japan) was used to observe the morphology of the bilayer-structured electrodes. The electrochemical properties were analyzed by a solar cell measurement system (K3000, McScience, Suwon, South Korea) under a solar simulator (xenon lamp, air mass (AM) 1.5, 100 mW cm−2). The extinction and diffused reflectance spectra were recorded on a UV/Vis spectrophotometer

(Cary 5000, Agilent Technologies, Santa Clara, CA, USA), and incident photon-to-current conversion selleck efficiency (IPCE) spectra were measured by an IPCE measurement system (K3100, McScience). Electrochemical impedance spectra (EIS) were taken by using a potentiostat (CHI 608C,

CH Instrumental Inc., Austin, TX, USA) to analyze the kinetic parameters in the DSSCs [19–21]. Results and discussion The crystalline structure and grain size of ZnO nanoparticles and nanoporous spheres were analyzed by XRD (Figure 1). The diffraction confirms the crystalline ZnO having hexagonal wurtzite structure (JCPDS #36-1451). From Williamson-Hall plots [22–24], the homemade ZnO nanoporous spheres are composed of approximately 35-nm-sized grains, while the grain size of the commercial ZnO nanoparticles is approximately AZD4547 research buy 55 nm.The ZnO bilayer electrodes were sequentially prepared by the bottom layer made by only ZnO nanoparticles and the top scattering layer formed with various mixing ratios of nanoparticles and nanoporous spheres. As shown in Figure 2, the plan-view SEM images of the scattering layers indicate that the nanoparticles and nanoporous spheres are mixed uniformly, not aggregated separately. The range of nanoporous sphere size is approximately 150 to 500 nm, with the average size of approximately 300 nm. As the

ratio of nanoporous spheres increases, void spaces in the film get larger. The cross-sectional SEM images show that bilayer structures consisting of the nanoparticle bottom layer and mixed scattering upper layer are composed nicely Selleckchem Ixazomib without any crushes at the interface The average thickness of the bilayer films is approximately 5.5 μm, and the selleck compound deviation is less than 10%. The poor connectivity among the ZnO nanoporous spheres with the decreased nanoparticle ratio is consistent with the plan-view SEM images. Figure 1 X-ray diffraction of the ZnO films consisting of only nanoparticles or nanoporous spheres. The peak intensities and positions from the hexagonal ZnO (JCPDS #36-1451) are shown as solid lines. Figure 2 Plan-view and cross-sectional SEM images of the ZnO bilayer electrodes. The weight ratios of nanoparticle (NP) to nanoporous sphere (NS) for the top layers are (a) 10:0, (b) 7:3, (c) 5:5, (d) 3:7, and (e) 0:10, respectively.

Such a tree would suggest that proteases within the groups 3b/3d

Such a tree would suggest that proteases within the groups 3b/3d developed before the proteases of group 3a and 4, which seems far-fetched since proteases of group 3a and 4 type cleaves hydrogenases that are deeper branched then the 3b/3d hydrogenases. We therefore suggest that the placement of HOX-specific proteases (3d) and the scattered

result of 3b proteases in the phylogenetic tree may be the result of horizontal gene transfer (HGT). HGT is today seen as a major force in evolution and has occurred numerous times between archaea and bacteria [30–33]. Within prokaryotes almost no gene family is untouched by HGT [34] and there are also numerous cases of HGT within cyanobacteria [35]. [NiFe]-hydrogenases have not been spared from this mechanism and an archaeal selleck screening library organism is believed to be the origin of the Ech- hydrogenase in Thermotoga maritima [36]. By comparing the phylogenetic tree of hydrogenases and

their specific protease and assuming that the [NiFe]-hydrogenase and its specific protease have evolved together the most likely scenario is that an early group 3 [NiFe]-hydrogenase with or without its specific protease was transferred, most probably from an archaeal organism to a bacterial. If we assume that the P5091 nmr type 3 hydrogenase and the protease transferred together then this indicates that most likely the root of the tree should be placed between group 3a and 4 (point Z; Figure 1) and that the protease transferred is the ancestor of all type 1, 2 and 3d proteases (Figure 8). If we assume the opposite, (that the hydrogenase transferred alone), then the root should instead be placed between type 1/2/3d and type 3a/4 proteases (point Y; Figure 1) and the transferred hydrogenase must have incorporated an already existing type 1 protease to its maturation process. The scattered impression of type 1 and 3b proteases from the less robust phylogenetic tree with additional

hydrogenase specific proteases (Additional file 1) could be the result e.g. older phylum branching off close to the HGT point, poor resolution of the phylogenetic tree or by additional Amino acid HGT and so does not contradict our proposed theory of HGT. Rooting the tree with an outgroup; germination protease (GPR), the closest relative to the [NiFe]-hydrogenase specific proteases, (data not shown) placed the root between group 3a and 4 suggest that the first scenario, a root between group 3a and 4, is more plausible (point Z; Figure 1). SAR302503 concentration However, all attempts at rooting the tree resulted in very unstable phylogenetic trees. When considering both GPR endopeptidase function (bacterial spoluration) and taxonomic location (bacterial phylum of firmicutes only) it is plausible that the [NiFe]-hydrogenase specific proteases are instead the ancestor of GPR, making any tree with GPR as outgroup unreliable.

EPW: Carried out the synthesis of the compounds used in this work

EPW: Carried out the synthesis of the compounds used in this work, and was involved in revising the manuscript critically. JVC: Carried out the supervision of the students involved in the synthesis of the compounds used in this work, and was involved in revising the manuscript critically. AAS: Designed the synthesized compounds and carried out the supervision

of the students involved in the synthesis of the compounds used in this work, and was involved in revising the manuscript critically. He was Trichostatin A solubility dmso involved in revising the manuscript critically and gave final approval of the final version. AFP: Helped with the conception and design the experiments; with analysis and interpretation of data and draft the manuscript. He was involved in revising the manuscript critically and gave final approval of the version to be published. All authors read and approved

the final manuscript.”
“Background Staphylococcus aureus Selleckchem Ku 0059436 (S. aureus) is one of the primary causes of bone infections [1–3]. These infections are often chronic, difficult to eradicate, and have high morbidity rates [4]. S. aureus can infiltrate deep into bone and soft tissue as a result of severe trauma or surgical implants [5]. Although S. aureus has www.selleckchem.com/products/Fedratinib-SAR302503-TG101348.html traditionally been considered an extracellular pathogen, it has been reported by several groups that this bacterium can invade and survive within a variety of cells such as neutrophils, macrophages, T-lymphocytes, epithelial cells, endothelial cells, fibroblasts, and osteoblasts [6–16]. One hypothesis, not yet proven, about chronic and recurrent infections is that bacteria internalize into host cells and the internalization may lead to the bacteria’s evasion of the host’s immune responses and provide protection from most conventional antibiotics [17,18].

The primary role of osteoblasts is to synthesize isometheptene bone components and induce bone matrix mineralization [19]. Osteoblasts are not traditionally considered part of the immune system. However, osteoblasts were recently found to be able to induce inflammatory cytokines and chemokines upon S. aureus internalization [20,21]. This finding may suggest an important role for osteoblasts in triggering immune responses after S. aureus infection. S. aureus can be internalized into osteoblasts and its internalization is believed to be mediated by binding of fibronectin-binding proteins on S. aureus surfaces and fibronectins on osteoblast surfaces, which are connected to the integrin dimer α5β1 molecule [6]. Protein-ligand interaction leads to S. aureus adhesion and invasion by a “zipper-like” mechanism [15]. Eventually, internalized bacteria escape into the cytoplasm and may lead to host cell death by apoptosis [22]. In addition, live osteoblasts are necessary for S. aureus internalization as S. aureus could not internalize into formalin-fixed osteoblasts [10,23].

Doheny, PhD, Kent State University, Strongsville, OH; Carol Sedla

Doheny, PhD, Kent State University, Strongsville, OH; Carol Sedlak, PhD, Kent State University, Kent, OH; Rosalie Hall, PhD, University

of Akron, Akron, OH; Alycia Perez, PhD, University of Akron, Akron, OH BACKGROUND: The newly developed technique of Exploratory Structural Equation Modeling (ESEM), which combines attributes of exploratory and confirmatory factor analysis, was used to investigate Selleck LGX818 measurement equivalence of all subscales of the Horan et al. Osteoporosis Health Belief Scale (OHBS) and the Osteoporosis Self-Efficacy Scale (OSES) in healthy postmenopausal women and older men. METHODS: OHBS and OSES measures were collected before intervention in two longitudinal HSP inhibitor drugs randomized clinical trials designed to study how receipt of personal dual energy x-ray absorptiometry (DXA) information influences osteoporosis preventing behavior (OPB). A series of models was estimated, first establishing fit of a single-group 9-factor model, and then testing nested multi-group models specifying the equivalence of factor loadings, factor means, and factor covariances across the two

gender groups. RESULTS: ESEM analyses demonstrated: (a) factor loading equivalence across the two samples for the set of 9 factors, as Selonsertib supplier indicated by a non-significant nested chi-square test, SB-scaled Δχ2 (405) = 430.076, p = .1874, with additional evidence provided by statistically significant (p < .001) factor profile similarity indices ranging from .62 to .98; (b)significant latent factor mean differences between the two samples, with men having higher levels Flavopiridol (Alvocidib) of exercise self-efficacy, health motivation and perceived barriers to calcium, and lower levels of perceived osteoporosis susceptibility and seriousness; and (c) equivalence of factor covariance relationships in the two samples. CONCLUSIONS: Discussion addresses

the implications of establishing measurement invariance, benefits of the ESEM approach, and conceptual explanations and nursing implications for the observed differences in latent factor means for behavior change. P2 DXA IN OLDER MEN WITH DOCUMENTED HEIGHT LOSS CAPTURES A SIGNIFICANT PERCENTAGE OF VULNERABLE HIGH-RISK PATIENTS Thomas P. Olenginski, M.D., FACP, Geisinger Medical Center, Danville, PA; Muhammad Ansar, M.D., Geisinger Medical Center, Danville, PA; Janet Dennen, None, Geisinger Medical Center, Danville, PA; Matt Hackenberg, None, Geisinger Medical Center, Danville, PA; Elizabeth Boyer, None, Geisinger Medical Center, Danville, PA; Eric Newman, M.D., Geisinger Medical Center, Danville, PA BACKGROUND: Men represent 20 % of the osteoporosis population. While many groups suggest DXA in men, there is no approved screening code.