Sydowia 52(1):46–58 Nei M, Kumar S (2000) Molecular evolution and

Sydowia 52(1):46–58 Nei M, Kumar S (2000) Molecular evolution and phylogenetics. Oxford University Press, New York Newsam A (1960) Plant Pathology Division Report. Rubber Research Institute of Malaysia Nugawela A, Liyanage NIS, Liyanage AS, Aluthhewage

RK (1989) Influence of infection by Corynespora cassiicola on carbon dioxide assimilation rate in Hevea leaves. J Nat Rubber Res 4(4):233–238 Okane I, Srikitikulchai P, Toyama K, Læssøe T, Sivichai S, Hywel-Jones N, Nakagiri A, Potacharoen W, Suzuki K-I (2008) Study of endophytic Xylariaceae in Thailand: diversity and taxonomy inferred from rDNA sequence analyses with saprobes forming fruit bodies in the field. Mycoscience 49(6):359–372. doi:10.​1007/​s10267-008-0440-6 CrossRef Oliveira RR, Vida JB, Tessmann DJ, SB202190 chemical structure Aguiar BM, Caixeta MP (2006) Reaçao de hibridos de MEK inhibitor pepino para cultivo protegido a isolados de Corynespora cassiicola. Fitopatol Bras 31:509–512CrossRef Oliveira RR, Vida JB, Tessmann DJ, BdM A, Caixeta MP, Barboza AL (2007) Patogenicidade de isolados de Corynespora cassiicola a diferentes espécies de plantas. Summa Phytopathol 33:297–299CrossRef Onesirosan P, Mabuni CT, Durbin RD, Morin RB, Righ DH, Arny DC (1975)

Toxin production by Corynespora cassiicola. Physiol Plant Pathol 5:289–295CrossRef Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29:e45PubMedCrossRef Photita W, Lumyong S, Lumyong P, McKenzie EHC (2004) Are some endophytes of Musa acuminata latent pathogens? Fungal Divers 16:131–140 Photita W, Taylor P, Ford R, Hyde K, Lumyong S (2005) Morphological and molecular characterization of Colletotrichum species from herbaceous plants in thailand. Fungal Divers 18:117–133 Pongthep K (1987) Corynespora disease of Hevea in Thailand. In: Proceedings of the IRRDB Symposium. Chiang

Mai, Thailand, 2–3rd Nov, pp 1–17 Porras-Alfaro A, Bayman P (2008) Hidden fungi, emergent properties: endophytes and microbiomes. Annu Rev Phytopathol 49(1):291–315. doi:10.​1146/​annurev-phyto-080508-081831 CrossRef Promputtha I, Lymyong S, Lumyong P, McKenzie EHC, Hyde KD (2002) Ribonucleotide reductase Fungal succession of senescent leaves of Manglietia garrettii in Doi Suthep-Pui National Park, northern Thailand. Fungal Divers 10:89–100 Promputtha I, Lumyong S, Dhanasekaran V, McKenzie EH, Hyde KD, Jeewon R (2007) A phylogenetic evaluation of whether endophytes R788 mouse become saprotrophs at host senescence. Microb Ecol 53(4):579–590PubMedCrossRef Promputtha I, Hyde K, McKenzie E, Peberdy J, Lumyong S (2010) Can leaf degrading enzymes provide evidence that endophytic fungi becoming saprobes? Fungal Divers 41(1):89–99. doi:10.​1007/​s13225-010-0024-6 CrossRef Purwantara A (1987) A histological study of hevea leaves infected by Corynespora cassiicola.

On the other hand, we may also change the material properties of

On the other hand, we may also change the material properties of the cylinder corner part. The nETR spectra for different materials of the cylinder corner part are displayed in Figure 4d. Here the radius is set to corresponding to the gap widths of g = 10 nm. The cases of material refraction index n = 1.5 and n = 3.4 are displayed together with the case of silver cylinder. We can see that when the material of the cylinder corner is changed, the resonance wavelength and #find more randurls[1|1|,|CHEM1|]# the maximum enhancement in the nETR spectra both vary slightly. The above results imply that the role of the corner part of V-shaped structures in nETR

is minor. Based on this, we may remove the corner part so that the V-shaped structure consists of two nanorod branches only, as GW2580 ic50 shown in Figure 3c. The nETR spectrum in this structure is also displayed in Figure 4d with n = 1; we can see that the resonance wavelength is 1,177 nm with a maximum enhancement of nearly 84,000. This

resonance wavelength is very close to that in the case of single nanorod structure, while the maximum enhancement is ten times higher than the latter. Compared with other V-shaped structures having corner parts, this simple structure is thus more suitable to be applied in practical experiment and applications in integrated photonic devices. In the above discussions, we proposed V-shaped structures with symmetric configuration for donor-dipole pair with symmetric Miconazole dipole directions; the directions of the donor and acceptor dipoles are both aligned to the principle axis of the nanorod branches. In order to further examine the controllability and robustness of these V-shaped structures, we now discuss the RET-enhancing abilities of these structures for donor-dipole pair with asymmetric configuration θ D = 60° and θ A = 30°. Figure 5a displays the nETR spectra in the V-shaped structures

shown in Figure 3a with a sharp corner part, θ 1 = θ 2 = 60°, and different gap widths g, compared with the case of single nanorod. Here we have θ A ≠ θ D and θ A ≠ θ 2; the direction of the acceptor dipole is thus a bit misaligned from the principle axis of the second nanorod branch. Compared with Figure 4a, the nETR in the single nanorod structure increases with a maximum enhancement of 23,300, while the RET-enhancing abilities of the V-shaped structures become weaker. Nevertheless, the nETR spectrum in the V-shaped structures can still be modulated by the lengths of the nanorod branches. The nETR spectrum in the V-shaped structure with a sharp corner part and g = 10 nm still has a maximum enhancement of about 59,000, stronger than that in the single nanorod structure. Figure 5b displays the nETR spectra for V-shaped structures with different corner parts shown in Figure 3 for g = 10 nm and . It can be seen that the RET-enhancing ability of the V-shaped structures is still robust.

CrossRef 20 Orr FW, Wang HH, Lafrenie RM, Scherbarth S, Nance DM

CrossRef 20. Orr FW, Wang HH, Lafrenie RM, Scherbarth S, Nance DM: Interactions between cancer cells and the endothelium in metastasis. J Pathol 2000, 190: 310–329.PubMedCrossRef 21. Tsuji T, Kawada Y, Kai-Murozono M: Regulation of melanoma cell migration and invasion

by laminin-5 and alpha3beta1 integrin (VLA-3). Clin Exp Met 2002, 19: 127–134.CrossRef 22. Michailova KN: Mesothelial lamellar bodies in norm and Go6983 price experimental conditions. Transmission and scanning electron microscopic observations on the peritoneum, pleura and pericardium. Anat Embryol (Berl) 2004, 208: 301–309.CrossRef 23. Liu Q, Mao H, Nie J: Transforming growth factor-beta1 induces epithelial-mesenchymal transition by activating the JNK-Smad3 pathway in rat peritoneal mesothelial cells. Peritoneal Dialysis Int 2008, 28: s88-s95. 24. Oh KH, Margetts PJ: Cytokines and growth factors involved in peritoneal fibrosis of peritoneal dialysis patients. Int J Artif Organs 2005, 28: 129–134.PubMed 25. Labat RJ: Fibronectin in malignancy. Semin Cancer Biol 2002, 12: 187–195.CrossRef 26. Shi Y, Massague J: Mechanisms of TGF-β

signaling from cell membrane to the nucleus. Cell 2003, 113: 685–700.PubMedCrossRef 27. Feng XH, Derynck R: Specificity and versatility in TGF-β signaling through Smads. Annu Rev Cell Dev Biol 2005, 21: 659–693.PubMedCrossRef 28. Tojo M, Hamashima Y, Hanyu A: The ALK-5 inhibitor A-83–01 inhibits Smad signaling and epithelial to-mesenchymal transition by transforming growth factor-β. Cancer Sci 2005, 96: 791–800.PubMedCrossRef 29. Nomura H, Nishimori Selleckchem ABT 737 H, Yasoshima T: A novel experimental mouse model of peritoneal dissemination of human gastric cancer cells: analysis of the mechanism of peritoneal dissemination using cDNA microarray. Jpn J Cancer Res 2001, 92: 748–754.PubMed 30. Margetts PJ, Kolb M, Galt T, Hoff CM, Shockley

TR, Gauldie J: Gene transfer of transforming growth factor-beta1 to the rat peritoneum: effects on membrane function. J Am Soc Nephrol 2001, 12: 2029–2039.PubMed 31. Van Grevenstein WM, Hofland LJ, Jeekel J, van Eijck CH: The expression of adhesion molecules and the influence of inflammatory cytokines on the adhesion of human pancreatic carcinoma cells to mesothelial monolayers. Pancreas 2006, 32: 396–402.PubMedCrossRef 32. Takatsuki H, eFT-508 in vivo Komatsu S, Sano R, Takada Y, Tsuji T: Adhesion of Arachidonate 15-lipoxygenase gastric carcinoma cells to peritoneum mediated by alpha3beta1 integrin (VLA-3). Cancer Res 2004, 64: 6065–6070.PubMedCrossRef Competing interests The authors declare that they have no competing interests. Authors’ contributions ZDL, DN, FNL and ZMD participated in most of the experiments. ZS and XYM participated in the design of the study and performed the statistical analysis. ZDL and ZL collected tissue specimens and drafted the manuscript. HMX and ZNW conceived of the study, and participated in its design and coordination. All authors read and approved the final manuscript.

Prior patient consent and approval from the Institutional Researc

Prior patient consent and approval from the Institutional Research Ethics Committee were obtained to use these clinical materials for research purposes. Clinical information on these samples is described in Table 1. Percentage tumor purity in sections adjacent to the regions used for RNA extraction was estimated during routine histopathological analysis. Normal lung tissues were obtained from First Affiliated Hospital of Shenzhen University by collecting donations from individuals who died in traffic accidents and were confirmed to be free of any prior pathologically detectable conditions. The tumors were staged according

to the 7th edition of the Cancer Stage Manual written www.selleckchem.com/products/beta-nicotinamide-mononucleotide.html by the American Joint Committee on Cancer (AJCC) [11]. Table 1 Clinicopathologic characteristics of studied patient and expression of SOX9 in NSCLC   No. (%) Gender   Male 103(72.5) Female 39(27.5) Age (years)   ≤ 65 89(62.7) >65 53(37.3) Pathology   Squamous cell carcinoma

47(33.1) Adenocarcinoma 68(47.9) Adenosquamous carcinoma Cediranib cost 27(19.0) NSCLC histology (AJCC grade)   I 32(22.5) II 25(17.6) III 58(40.8) IV 27(19.0) Survival (n = 89)   Alive 33(37.1) Dead 56(62.9) Survial time of low expression      Mean 31.70      Median 28.50   Survival time of high expression      Mean 24.84      Median 24.00   Expression of SOX9   Negative 7(4.9) Positive 135(95.1) Low expression 68(47.9) High expression 74(52.1) RNA extraction and HM781-36B ic50 Real-time reverse transcription-polymerase chain reaction Total RNA from cultured cells was extracted using the TRIzol reagent Carbohydrate (Invitrogen) and purified using the purelink RNA

Mini Kit (Invitrogen) according to the manufacturer’s instructions. Real-time reverse transcription-polymerase chain reaction (RT-PCR) was employed to quantify the change of SOX9 mRNA level in lung cancer cell lines compared with that in normal human pneumonocytes. Real-time RT-PCR primers and probes for SOX9 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were designed with the assistance of the Primer Express version 2.0 software (Applied Biosystems). Primer sequences SOX9 forward primer: 5′-CGAAATCAACGAGAAACTGGAC-3′, SOX9 reverse primer: 5′-ATTTAGCACACTGATCACACG-3′, SOX9 probe 5′-(FAM) CCATCATCCTCCACGCTTGCTCTG (TAMRA)-3′, GAPDH forward primer: 5′-GACTCATGACCACAGTCCATGC-3′, GAPDH reverse primer: 5′-AGAGGCAGGGATGATGTTCTG-3′, GAPDH probe 5′-(FAM) CATCACTGCCACCCAGAAGACTGTG (TAMRA)-3′. Expression data were normalized to the housekeeping gene GAPDH and calculated as 2-[(Ct of gene) - (Ct of GAPDH)], where Ct represents the threshold cycle for each transcript. Western blotting Cells were harvested in sampling buffer and boiled for 10 min. The procedure was perfomed similarly to previously described methods [12]. Protein concentration was determined with the bicinchoninic acid (BCA) assay (Pierce, Rockford, USA) according to the manufacturer’s instructions.

Thus, even though permeating and non-permeating solutes had the s

Thus, even though permeating and non-permeating solutes had the same effect on specific growth rates (Figure 1), these solutes affect cells in fundamentally different ways. Future work is now needed to test whether the responses to permeating and non-permeating solutes accurately simulate the responses to the solute and matric components of the total water potential, respectively, and to connect these responses with those observed in more realistic scenarios of soil desiccation.

Acknowledgements and funding We thank the European Community program FP7 (grant KBBE-211684) (http://​cordis.​europa.​eu/​fp7/​home_​en.​html) for financial support of this project. We thank Regina-Michaela Wittich for kindly providing strain RW1 and Jacques Schrenzel for helpful advice about cDNA labeling protocols. We thank the DNA Array Facility at the University of Lausanne for assistance with find more microarray analyses. Electronic supplementary

material PD173074 solubility dmso Additional file 1: Complete list of genes whose expression levels responded to short-term perturbation with sodium chloride or PEG8000 (FDR < 0.05, fold difference > 2.0). (XLSX 53 KB) Additional buy Talazoparib file 2: Complete list of genes whose expression levels responded to short-term perturbation with sodium chloride but not PEG8000 (FDR < 0.05, fold difference > 2.0). (XLSX 59 KB) Additional file 3: Complete list of genes whose expression levels responded to short-term perturbation with PEG8000 but not sodium chloride (FDR < 0.05, fold difference > 2.0). (XLSX 56 KB) Additional file 4: Complete list of genes whose expression levels

responded Bcl-w to long-term perturbation with PEG8000 (FDR < 0.05, fold difference > 2.0). (XLSX 57 KB) References 1. Hiraishi A: Biodiversity of dioxin-degrading microorganisms and potential utilization in bioremediation. Microbes Environ 2003, 18:105–125.CrossRef 2. Wittich RM, Wilkes H, Sinnwell V, Francke W, Fortnagel P: Metabolism of dibenzo- p -dioxin by Sphingomonas sp. strain RW1. Appl Environ Microbiol 1992, 58:1005–1010.PubMed 3. Wilkes H, Wittich R, Timmis KN, Fortnagel P, Francke W: Degradation of chlorinated dibenzofurans and dibenzo- p -dioxins by Sphingomonas sp. strain RW1. Appl Environ Microbiol 1996, 62:367–371.PubMed 4. Armengaud J, Happe B, Timmis KN: Genetic analysis of dioxin dioxygenase of Sphingomonas sp. strain RW1: catabolic genes dispersed on the genome. J Bacteriol 1998, 180:3954–3966.PubMed 5. Wittich RM: Degradation of dioxin-like compounds by microorganisms. Appl Microbiol Biotechnol 1998, 49:489–499.PubMedCrossRef 6. Halden RU, Halden BG, Dwyer DF: Removal of dibenzofuran, dibenzo-p-dioxin, and 2-chlorodibenzo-p-dioxin from soils inoculated with Sphingomonas sp strain RW1. Appl Environ Microbiol 1999, 65:2246–2249.PubMed 7. Harris RF: Effect of water potential on microbial growth and activity. In Water Potential Relations in Soil Microbiology. SSA Special Publication Number 9. Edited by: Parr JF, Gardner WR, Elliot LF.

Recently, several ways have been developed to solve the

Recently, several ways have been developed to solve the thickness effect in (RE) BCO films. Using multilayer technology, Selleck Adriamycin Foltyn et al. have achieved J c values of up to 4.0 × 106 A/cm2 in the film with a thickness

of 3.5 μm, at_75 K, self-field on metal substrates [9]. Tran et al. have overcome the rapid decrease of J c value by BaSnO3 addition in (Gd) BCO films [23]. Feldmann et al. achieved a J c (75.6 K, self-field) of 5.2 × 106 A/cm2 in a single-layer 2.0-μm-thick YBCO film with BaZrO3 (BZO) and Y2O3 additions [24]. Dürrschnabel et al. obtained the J c of (Dy) BCO film to be 1.7 × 106 A/cm2 at 77 K and self-field with a thickness of 5.9 μm on inclined substrate-deposited MgO-buffered Hastelloy substrates [25]. These research results are exciting. Our next research work will focus

Selleck Selonsertib on finding methods to overcome the thickness effect in (RE) BCO films. Conclusions GdBCO films with different thicknesses are prepared on CeO2/YSZ/CeO2-buffered Ni-W substrates by means of RF sputtering. The stress and microstructure of the GdBCO films with various thicknesses are investigated by XRD, SEM, AFM, and XPS techniques. click here For the 200-nm-thick film, the highest J c value of 4.0 MA/cm2 has been obtained. The highest J c value is attributed to high-level compressive stresses for the 200-nm-thick film. A nearly linear relationship between I c and film thickness is observed as the film thickness increases from 200 to 1,030 nm. It is realized that differences of stress and roughness do not affect the supercurrent carrying ability with increasing film thickness. We find that when the film thickness approaches

to a certain value about 1,030 nm, the a-axis grains appear at the upper surface. As a result, more and more a-axis grains lead to lots of grain gaps, which will PIK-5 certainly reduce the effective supercurrent carrying cross section. In addition, oxygen deficiency is found for upper layers beyond 1,030 nm for F1450 and F2100. It can be understood that the slower increase of I c for the 1,450-nm-thick film and no increase of I c for the 2,100-nm-thick film are due to a-axis grains, gaps between a-axis grains, and oxygen deficiency for the upper layers of the thick film. Acknowledgements This work is supported by the ITER Plan Project (grant no. 2011GB113004), Shanghai Science and Technology Committee (grant no. 11DZ1100402), Graduate Student Innovation Ability Training Special Fund projects (grant no. Z-072-004), National Science and Technology (grant no. 11204174), and Shanghai Youth Science and Technology The Phosphor Plan (tracking) (grant no. 11QH140100). The authors gratefully thank the Instrumental Analysis Center of Shanghai Jiao Tong University and MA-tek analytical lab for the competent technical assistance. References 1. Larbalestier D, Gurevich A, Feldmann DM, Polyanskii A: High-T-c superconducting materials for electric power applications. Nature 2001, 414:368–377.CrossRef 2.

Recombinant Pseudomonas sp B4 that overexpressed yeast exopolyph

Recombinant Pseudomonas sp. B4 that overexpressed yeast exopolyphosphatase also showed the functional deficiencies in motility and biofilm development reported for ppk1 mutants from P. aeruginosa PAO1 [21]. In addition, new structural and

functional defects such as MCC 950 changes in colony morphology, LPS structure and cellular division are reported in this communication. Finally, to study the proteomic changes that occurred during polyP deficiency recombinant strains were compared under different growth conditions and phases of growth. Interesting proteins related to energetic metabolism were overexpressed this website during polyP scarcity, such as three enzymes from the tricarboxylic acid (TCA) cycle, and one ATP synthase subunit. Protein folding, fatty acid catabolism and amino acid biosynthesis were other gene onthology (GO) categories overrepresented during polyP deficit. On the other hand, motility and transport proteins were the only categories underrepresented in this condition.

The proteomics results suggest a link between polyP and central metabolism that can be further explored to clarify the multiple structural and functional defects found during the lack of polyP in bacteria. Results Structural and functional defects in polyphosphate deficient bacteria Overexpression of PPX resembled the functional defects found in motility and biofilm formation in a ppk1 mutant from P. aeruginosa PAO [21]. Despite several MLN2238 clinical trial functional Etofibrate and structural defects have been reported in P. aeruginosa PAO1 ppk1 mutant [15, 21, 22], our polyP deficient cells showed new functional and structural phenotypes not previously reported. PPK1 is essential for biofilm development and virulence of P. aeruginosa PAO1. Considering that lipopolysaccharide

(LPS) is also very important in both cellular processes; the electrophoretic profile of LPS from recombinants Pseudomonas sp. B4 were analyzed. Interestingly, changes in the core of the LPS were observed in Tricine/SDS-polyacrylamide gel electrophoresis (Figure 1). To our knowledge, the structure of the LPS core from Pseudomonas sp. B4 has not yet been elucidated and consequently it is difficult to determine the structural nature of the change found in the LPS core. It would be interesting to determine the structure of LPS in both strains [control and polyP(-)] to reveal the change in the LPS and its probable link with polyP. Figure 1 LPS profiles of polyP-deficient cells of Pseudomonas sp . B4. Equal numbers of Pseudomonas sp. B4 polyP-deficient and control cell samples were loaded in each lane and analysed by 12% (w/v) PAGE by using a Tricine-SDS buffer system. LPS from Salmonella serovars Typhi was used as LPS control (lane M). The arrow indicates the change seen in a band of the inner core. RU: repetitive units. It was found that inorganic polyP influences not only biofilm formation but also colony morphology phenotype.

PubMedCrossRef 8 Tan D, Xue YS, Aibaidula G, Chen GQ: Unsterile

PubMedCrossRef 8. Tan D, Xue YS, Aibaidula G, Chen GQ: Unsterile and continuous

#INCB28060 purchase randurls[1|1|,|CHEM1|]# production of polyhydroxybutyrate by Halomonas TD01. Biorescour Technol 2011, 102:8130–8136.CrossRef 9. Schwibbert K, Marin-Sanguino A, Bagyan I, Heidrich G, Lentzen G, Seitz H, Rampp M, Schuster SC, Klenk HP, Pfeiffer F, Oesterhelt D, Kunte HJ: A blueprint of ectoine metabolism from the genome of the industrial producer Halomonas elongata DSM 2581 T. Environ Microbiol 2011, 13:1973–1994.PubMedCrossRef 10. Vargas C, Tegos G, Vartholomatos G, Drainas C, Ventosa A, Nieto JJ: Genetic organization of the mobilization region of the plasmid pHE1 from Halomonas elongata . Syst Appl Microbiol 1999, 22:520–529.PubMedCrossRef 11. Vargas C, Tegos G, Drainas C, Ventosa A, Nieto JJ: Analysis

of the replication region of the cryptic plasmid pHE1 from the moderate halophile Halomonas elongata . Mol Gen Genet 1999, 261:851–861.PubMedCrossRef 12. Mobberley JM, Authement RN, Segall AM, Paul JH: The temperate marine phage PhiHAP-1 of Halomonas aquamarina possesses a linear plasmid-like prophage Semaxanib datasheet genome. J Virol 2008, 82:6618–6630.PubMedCrossRef 13. D’Hugues P, Norris PR, Hallberg KB, Sánchez F, Langwaldt J, Grotowski A, Chmielewski T, Groudev S: Bioshale consortium: bioshale FP6 European project: exploiting black shale ores using biotechnologies? Miner Eng 2008, 21:111–120.CrossRef 14. Gibson TJ: Studies on Epstein-Barr genome. PhD thesis. selleckchem University of Cambridge; 1984. 15. Ludtke DN, Eichorn BG, Austin SJ: Plasmid-partition functions of the P7 prophage. J Mol Biol 1989, 209:393–406.PubMedCrossRef 16. Hooykaas PJJ, den Dulk-Ras H, Schilperoort RA: Molecular mechanism of Ti plasmid mobilization by R plasmids: isolation of Ti plasmids with transposon insertions in Agrobacterium tumefaciens . Plasmid 1980, 4:64–75.PubMedCrossRef 17. Bartosik D, Baj J, Plasota M, Piechucka E, Wlodarczyk M: Analysis of Thiobacillus versutus pTAV1 plasmid functions. Acta Microbiol Pol 1993, 39:5–11. 18. Bartosik D, Bialkowska A, Baj J, Wlodarczyk M: Construction of mobilizable cloning vectors derived

from pBGS18 and their application for analysis of replicator region of a pTAV202 mini-derivative of Paracoccus versutus pTAV1 plasmid. Acta Microbiol Pol 1997, 46:387–392.PubMed 19. Kovach ME, Phillips RW, Elzer PH, Roop RM II, Petersen K: pBBR1MCS: a broad-host-range cloning vector. Biotechniques 1994, 16:800–802.PubMed 20. Szuplewska M, Bartosik D: Identification of a mosaic transposable element of Paracoccus marcusii composed of insertion sequence IS Pmar4 (IS As1 family) and an IS 1247a -driven transposable module (TMo). FEMS Microbiol Lett 2009, 292:216–221.PubMedCrossRef 21. Sambrook J, Russell DW: Molecular Cloning: a Laboratory Manual. 3rd edition. New York, NY: Cold Spring Harbor Laboratory Press; 2001. 22.

Suomalainen LR, Tiirola MA, Valtonen ET: Influence of rearing con

Suomalainen LR, Tiirola MA, Valtonen ET: Influence of rearing conditions on Flavobacterium columnare infection of rainbow trout, Oncorhynchus mykiss (Walbaum). J Fish Dis 2005,28(5):271–277.PubMedCrossRef 46. Lorenzen E, Olesen NJ: Characterization of isolates of Flavobacterium psychrophilum associated with coldwater disease or rainbow trout fry syndrome II: serological studies. Dis Aquat Organ 1997, 31:209–220.CrossRef 47. Green DM, Gregory A, Munro LA: Small- and large-scale

network structure of live fish movements in Scotland. Prev Vet Med 2009,91(2–4):261–269.PubMedCrossRef 48. Tonolla M, Peduzzi S, Hahn D, selleckchem Peduzzi R: Spatio-temporal distribution of phototrophic sulfur bacteria in the chemocline of meromictic Lake Cadagno (Switzerland). S3I-201 supplier FEMS Microbiol Ecol 2003,43(1):89–98.PubMedCrossRef 49. Griffiths E, Gupta RS: Signature sequences in diverse proteins provide evidence for the late divergence of the Order Aquificales.

Int Microbiol 2004,7(1):41–52.PubMed 50. Yamamoto S, Harayama S: PCR amplification and direct sequencing of gyrB genes with universal primers and their application to the detection and taxonomic analysis of Pseudomonas putida strains. Appl Environ Microbiol 1995,61(10):3768.PubMed 51. Tamura K, Dudley J, Nei M, Kumar S: MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007,24(8):1596–1599.PubMedCrossRef 52. Bikandi J, San Millan R, Rementeria A, Garaizar J: In silico analysis of complete bacterial genomes: PCR, AFLP-PCR and endonuclease restriction. Bioinformatics 2004,20(5):798–799.PubMedCrossRef 53. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local alignment search tool. J Mol Biol 1990,215(3):403–410.PubMedCrossRef 54. Hellemans J, Mortier G, De Paepe A, Speleman F, Vandesompele J: qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome

Biol 2007,8(2):R19.PubMedCentralPubMedCrossRef 55. Mackay selleck inhibitor IM: Real-time PCR in the microbiology laboratory. Clin Microbiol Infect 2004,10(3):190–212.PubMedCrossRef 56. Yun JJ, Heisler LE, Hwang II, Wilkins O, Lau SK, Hyrcza M, Jayabalasingham B, Jin J, McLaurin J, Tsao MS, Der SD: Genomic DNA functions as a universal external standard in quantitative real-time PCR. Nucleic Acids Res 2006,34(12):e85.PubMedCentralPubMedCrossRef 57. Joly P, Falconnet PA, Andre J, Weill N, Reyrolle M, check details Vandenesch F, Maurin M, Etienne J, Jarraud S: Quantitative real-time Legionella PCR for environmental water samples: data interpretation. Appl Environ Microbiol 2006,72(4):2801–2808.PubMedCentralPubMedCrossRef Competing interests The authors declare that they have no competing interests. Authors’ contributions NS conceived the study, carried out the Taqman quantitative PCR, analyzed the results and drafted the manuscript. OP participated in the design of the study, analyzed the results and helped in writing the manuscript.

In Figure  5, different stages of the growth have been imaged by

In Figure  5, different stages of the growth have been imaged by in situ STM, up to a final Ge coverage of 12 monolayers (MLs). It can clearly be seen that three-dimensional structures selectively form inside the trenches; the three-dimensional mounds grow and coalesce until the whole trench is selleck screening library completely filled up, leading to the formation of a long in-plane wire. High-resolution

images, displayed in Figure  6, reveal that the wires are bounded by lateral 113 facets. Moreover, following the underlying mesh of the trenches, the wires show micrometer-length straight sections (Figure  6d) which alternate with junction nodes selleck products (Figure  6e). Cross-sectional TEM measurements clearly confirm the presence of the shallow trenches

under the wires (Figure  3b) and also show the absence of any subsurface dislocation defect close to the substrate/wire interface. This indicates that only the presence of the trench is enough to bias the growth of Ge to heterogeneous nucleation. Figure 5 Wire formation. (a , b , c , d , e , f) STM images showing different stages of the formation of the wires. The total Ge coverage is 12 MLs. Figure 6 Wire faceting. (a , b , c , d , e) STM images showing the morphology of the wires. The bottom insets of (c) show, respectively, (left panel) Selleckchem Ilomastat the line profile and (right panel) the FP of the wire in (c). Being the result of homoepitaxial growth, the wires are totally strain-free. We now show that epitaxial strain introduced by Si deposition dramatically alters

the growth morphology, determining a shape transition from wires to dots. As soon as Si is deposited, we notice the formation of faceted squared and rectangular dots along the wires (Figure  7). These dots progressively grow at the expense of the wires, until the latter completely disappear. By carefully analyzing the STM images of the dot assembly, it is still possible, however, to notice the residual imprint of the wires, appearing as a shallow mound along which the dots are aligned (Figure  7e). Table  1 summarizes the morphological parameters of wires and dots obtained 17-DMAG (Alvespimycin) HCl from a statistical analysis of STM and AFM images. It can be noticed that, during the shape transition, the total volume of nanostructures is preserved: The micrometer-long wires are replaced by a large number of dots, which show a bimodal size distribution. By inspecting in details the morphology of the dots (Figure  8), it can be seen that the islands are either squared or elongated pyramids (huts), again bounded by 113 facets, as indicated by the FP analysis (Figure  8c).This suggests that the observed shape change is not driven by the appearance of new stable facets with strain, but rather by a more efficient strain relaxation or a better surface/elastic energy gain which favors the islands over the wires.