The purity and concentration of the RNA extracted from each culture sample was determined using an Agilent 2100 bioanalyzer (Agilent Technologies). Reverse-transcription-PCR (RT-PCR) A RNA-primer hybridization mix containing 2 μl DNase-treated total RNA and 10 ng/μl random hexamer primers (Invitrogen) was incubated in a thermocycler at 70°C for 10 min followed by 25°C for 10 min. The 60 μl cDNA synthesis mixture contained the RNA-primer mix, 0.5 mM dNTP mix, 1 × first strand buffer (Invitrogen), 10 mM dithiothreitol, 0.5 U/μl SUPERase•In (Ambion) and 6.7 U/μl SuperScript III reverse transcriptase (Invitrogen). The mixture was incubated

at 25°C for 10 min, signaling pathway 37°C for 60 min, 42°C for 60 min and then at 70°C for 10 min to inactivate the SuperScript III. cDNA was stored click here at -80°C until used for real-time PCR. Primer design for quantitative real-time PCR (qPCR) Primers were designed for qPCR using Primer Express® Software v3.0, which considers factors such as amplicon size, homology with other genes, secondary structure and the estimated duplex melting temperature (T m ). Primers were designed using partial sequences retrieved

from GenBank (http://​www.​ncbi.​nlm.​nih.​gov/​genbank/​) for emhA (AAQ92180), emhB (AAQ92181) and emhC (AAQ92182) of P. fluorescens cLP6a [18] and the 16S rRNA gene of P. fluorescens pf0-1 (NC_007492) [21], the latter being used as the endogenous control. Primer pairs designed for each gene are listed in Table 1. Table 1 Primers for qPCR analysis Gene Forward primer (5′ → 3′) Reverse primer (5′→ 3′) emhA CGGTGAGCCGTCAGGAATAC TTGATCTGGGCGCTTTGC emhB

GTCCCACTGGCGATTTCC CCGTGATCATACCGCCAATAA emhC GATCGCCTGGCGCAACT CTTTCGCAGTCTGCTCATTCC 16S rRNA GGAGACTGCCGGTGACAAACT TGTAGCCCAGGCCGTAAGG RT-qPCR qPCR of cDNA was performed using an ABI 7500 Fast Real-Time PCR System (Applied Biosystems). Each 10-μ1 RT-qPCR reaction mixture containing 2.5 μl cDNA and 0.4 μM of each corresponding primer specific for target genes or the endogenous control was incubated with a reaction ADAMTS5 mixture (Molecular Biology Services Unit, Edmonton, Canada) comprising 5 μl 2 × qPCR reaction mix with SYBR Green (Molecular Probes) as the detection dye and ROX (Invitrogen) as a normalizing dye. The PCR conditions consisted of a denaturation cycle at 95°C for 2 min, followed by 40 cycles at 95°C for 30 s and 60°C for 1 min, and a dissociation cycle at 95°C for 15 s, 60°C for 1 min, 95°C for 15 s and then 60°C for 15 s. The melting curve generated at the end of real-time PCR cycles was analysed to confirm the absence of nonspecific double stranded DNA-SYBR Green hybrids.