SGLT Pathway sequence data of the clone clone were 880 and 8880 registered

Ions were in a DNA fragment having SGLT Pathway promoter clone 880 by fehleranf Introduced llige PCR, the 30 mutant derivatives. After the screening of the reactivity of t derived from promoters of radiation was 880 8 clone chosen as the best of all promoter and 10.4 times improvement in response to 10 Gy R-Rays, the promoter of weight Was selected found that four point mutations. The sequence data of the clone clone were 880 and 8880 registered at GenBank under the accession number or numbers and HQ418221 HQ418222. The production of the recombinant retrovirus and infection pRetroQ A retroviral vector generation AcGFP1 N 1 was purchased from Takara Bio. The luciferase gene was obtained by PCR tgaattctatcttatcatgtctgctcg pGL3 control using a model with a primer pair 50 CGCGG gcccaccatggaagacgccaaaaa 30 and 50 cc 30th After digestion with EcoRI and SmaI, the amplified fragment was purified and inserted into the EcoRI and SmaI sites of ligated pRetroQAcGFP1 N 1, the construction of a new plasmid designated pRetroQ luc by replacing Ant the GFP gene with the gene luciferase.

SGLT Pathway chemical structure

Clone 880 8 promoter was amplified by PCR using pGL3 8880 AU as a template with a primer pair 50 and 50 tcttccagcggatagaatgg verst ggagctcttacgcgtgctac 30 30 RKT. After digestion with BglII and NcoI, the PCR product was purified and inserted into the NcoI and BglII sites of pRetroQ luc, whereby a new plasmid, prepared 880 8 hatch. A DNA fragment contains Lt the SV40 promoter was amplified by PCR using pGL3 control in accordance with a model with a primer pair 50 cgcagatctcatctcaattagtcagcaac gcgggatcctttgcaaaagcctaggcctc verst 30 and 50 30 RKT. After digestion with BglII and NcoI, the PCR product was purified and inserted into the BglII and NcoI pRetroQ luc, whereby a new plasmid, ready SV40 luc, which was used as a vector controlled The. , Recombinants expressing a suicide gene construct, the gene fusion fcy :: fur encoding cytosine deaminase and uracil phosphoribosyl transferase, a DNA fragment which has been obtained, the fusion gene fcy :: fur with the Flag tag sequence by PCR using a plasmid, fur :: pORF5 Fcy, as a PCR template with a primer pair 50 ggctctagattatttagtagtatctgtccc gagacagaggagaccatggtcac 30 and 50 30 After digestion with XbaI and NcoI, the PCR products were purified. The fragment was cloned into the.
NcoI and XbaI sites of 880 8 Luke prepared a new plasmid, ready FCY 880 8 :: fur, inserted replaced build Ant gene fusion protein with the luciferase gene, and a another plasmid, the fusion protein of the fur :: currency transfer gene under the control the SV40 promoter in order to control recombinant viruses was fa Hnliches by insertion of the fragment with the gene PCRamplified luciferase gene fused Pret formed SV40-luc plasmid to a new, ready to provide SV40 fcy :: fur. Total of 100 000 cells AmphoPack293 on collagen-coated 60 mm cell culture dish were seeded and the next day T they were transfected with transfection CalPhosTM in S Ugern with a dose of 10 mg Pret 880 8 Luke. The virus contains Lt conditioned medium collected 48 hours after transfection and to remove through 0.45 mm filters. Polybrene was added to the filtered medium to a final concentration of 7.0 mgml1. These ready-L Solution was used as a source of the virus to infect cells LNCaP 1106th The infected cells were concentrated by puromycin treatment to 0.

Leave a Reply

Your email address will not be published. Required fields are marked *

*

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong>