Patients with a P. aeruginosa positive culture were treated according to the standard antibacterial treatment protocols of each Luminespib mouse center, patients with only a PCR positive result were not treated. Sample processing After arrival at the Laboratory Bacteriology Research (LBR), sputum and nasopharyngeal samples were liquefied with Sputasol (Oxoid Ltd., Basingstoke, UK) (1:1, vol/vol, 1 h incubation at 37°C). Throat swabs (ESwab, Copan, Brescia, Italy) were vortexed in the liquid transport medium present in the Eswab tube. For microbiological culture, samples were immediately processed after arrival. For qPCR, at least 200 μl of each sample was stored at -80°C prior to DNA-extraction. Culture and identification

of the bacteria Fifty μl of the samples were inoculated onto MacConkey Agar plates (Becton Dickinson, Erembodegem, Belgium) and 100 μl into 4 ml Cetrimide Broth (Fluka Biochemika, Buchs, Switzerland) and incubated for at least 24 h at 37°C at ambient atmosphere before examination. Cetrimide Broth was subcultured by inoculating 50 μl onto a Sheep Blood Agar plate (Becton Dickinson), which was also incubated for at least 24 h at 37°C before examination. After a maximum of Selleckchem EGFR inhibitor 5 days incubation, lactose

negative colonies on MacConkey Agar were picked, subcultured onto a 5% Sheep Blood Agar plate (Becton Dickinson) and identified using tDNA-PCR [12]. DNA-extraction Before DNA-extraction, respiratory samples were pre-incubated with proteinase K, i.e. incubation of 200 μl of each sample during 1 h at 55°C in 200 μl proteinase K buffer (1 Parvulin mg/ml proteinase K, 0.5% SDS, 20 mM Tris-HCl, pH 8.3) with vortexing every 15 min. DNA was extracted using the protocol Generic 2.0.1 on the bioMérieux easyMAG Nuclisens extractor

(bioMérieux, Marcy-l’Etoile, France). Final elution volume was 110 μl. This DNA-extraction protocol had been shown previously to be the most sensitive of five different methods [13]. Quantitative PCR Quantitative PCR (qPCR), targeting the oprL gene (NP_249664), was performed using primers PAO1 A (5′ CAGGTCGGAGCTGTCGTACTC 3′) and PAO1 S (5′ ACCCGAACGCAGGCTATG 3′) and hydrolysis probe oprL TM (5′ FAM-AGAAGGTGGTGATCGCACGCAGA-BBQ 3′), manufactured by TIB Molbiol (Berlin, Germany), as described previously [13]. The reaction mixture contained 4 μl of the LightCycler TaqMan Master mix (Roche, Basel, Switzerland), 0.5 μM of each primer, 0.1 μM of the hydrolysis probe, and 5 μl of DNA extract. The final reaction volume was made up to 20 μl by adding water. Cycling was performed on the LightCycler 1.5 (Roche) with an initial hold of 10 min at 95°C, 45 cycles at 95°C for 10 s, at 55°C for 30 s and at 72°C for 1 s. Using qPCR, the concentration of P. aeruginosa in the respiratory sample is determined as the cycle number whereby the fluorescence signal intensity crosses the INK128 detection threshold. This value is expressed as the quantification cycle (Cq). The number of cycles is inversely correlated to the concentration of P.