Luis, MO, US) supplemented with 40% of heat-inactivated fetal bovine serum (Lonza Basel, Switzerland), 20 mM penicillin, erythromycin, streptomycin solution (Sigma-Aldrich Co), 20 mM glutamax (Invitrogen selleck kinase inhibitor Co), 50 mg Gentamicine sulfate salt (Sigma-Aldrich Co). Human neuroblastoma SH-SY5Y cells were cultured under standard conditions (37��C; 95% air:5% CO2) in 50% MEM and 50% F12 nutrient medium (Sigma-Aldrich Co), supplemented with 10% fetal bovine serum, 2 mM glutamax, and 1% of a penicillin-streptomycin solution. pcDNA3.1Zeo- plasmid transfections were performed by Lipofectamine 2000 (Invitrogen Co) following manufacturer’s protocol. Genomic DNA extraction, cloning and sequencing A pool of 5 larvae at 4 dpf was dissolved in 10 mM Tris-HCl pH 7.5, 1 mM EDTA, 50 mM KCl, 0.3% Tween 20, 0.

3% NP40 and incubated for 10 minutes at 98��C. 0.1 U Proteinase k (Roche Diagnostic, Roche Werk, Penzberg, Germany) was added to the lysis buffer and incubation continued for 2 h at 55��C. The enzyme was inactivated at 98��C for 10 min. The lysate was used as source of genomic DNA. The region of 622 bp comprehensive of the S-MPO complementary sequence was cloned from 1 ��g of genomic DNA with 0,5 ��M of primers (forward primer: ACGAACACTAAGTGACTCTGGCAGA; reverse primers: ATCACGTTCCACCATGTCGACACT). The amplicon was analyzed by 2.5% agarose gel electrophoresis, extracted with the DNA Extraction from agarose gel kit (Qiagen) and sequenced (ABI PRISM 3100, Applied Biosystems).

Zebrafish cathepsin D affinity chromatography purification 4 dpf larvae (n=500)
Oesophagogastric cancer is a major public health problem and is the fourth highest cause of cancer-related mortality AV-951 globally (Kamangar et al, 2006). Although chemotherapy can improve survival and maintain quality of life for patients with advanced oesophagogastric cancer (Glimelius et al, 1995), optimal chemotherapy for this disease has not been defined. A recent randomised phase III study showed that adding docetaxel to cisplatin and 5-FU (TCF) improved response rates, progression-free survival (PFS) times, and overall survival (OS) (Van Cutsem et al, 2006). Although the TCF regimen improved clinical outcomes, it was also associated with toxicity, particularly that related to myelosuppression, with a 29% incidence of febrile neutropenia or neutropenic infection. Several studies have compared weekly with 3-weekly treatment with docetaxel. Weekly docetaxel is associated with minimal myelosuppression, but with a higher rate of cumulative fatigue, tearing, and nail toxicity (Engels and Verweij, 2005). We postulated that combination regimens using weekly docetaxel may provide palliative benefit for patients with advanced oesophagogastric cancer.