flexneri) to localize at the cell pole(s) (Jain et al., 2006). The NalP autotransporter from Neisseria meningitidis localizes to the poles of E. coli during heterologous expression of the protein (Jain et al., 2006). In addition, the Listeria monocytogenes surface protein ActA localizes to the bacterial pole, where it is involved in actin-based motility (Rafelski & Theriot, 2006). These examples indicate that an array of bacterial virulence stratagems use polar localization as a means to secrete effector proteins into host cells. Coxiella burnetii’s ability to affect host cell function while sequestered in the PV, and the lack of understanding of its T4BSS structure,

led us to investigate the subcellular localization of the C. burnetii T4BSS. Using antibodies specific to the C. burnetii IcmT, IcmV, and DotH homologs, Cetuximab indirect immunofluorescent antibody (IFA) assays demonstrated that IcmT, IcmV, and DotH localized to one or both poles of the bacterium. We confirmed these findings with immunoelectron microscopy (IEM). To our knowledge, this is the first demonstration of the specific subcellular

localization of this virulence machinery during C. burnetii infection. Coxiella burnetii Nine Mile Phase II Clone 4 (NMII) was propagated in African green monkey kidney (Vero) cells in Roswell Park Memorial Institute (RPMI) 1640 medium, 5% fetal bovine serum (FBS) at 37 °C in an atmosphere of 5% CO2, and the SCV form of the organism was isolated as described previously (Coleman et al., 2004). The SCVs were resuspended in SPG buffer (0.7 M sucrose, 3.7 mM KH2PO4, 6.0 mM K2HPO4, 0.15 M KCl, selleck chemical and 5.0 mM glutamic acid, pH 7.4) and stored at −80 °C. Coxiella burnetii genome equivalents were calculated using qPCR (Brennan & Samuel, 2003). Uninfected Vero cells were propagated as described in a medium containing 20 μg mL−1 gentamicin. The medium was exchanged with fresh RPMI 1640, 5% FBS without antibiotics 2 h before bacterial infection. Vero cells were infected with C. burnetii NMII using a genome-equivalent HA1077 MOI of

100. Infections were propagated as described for 3 weeks with periodic medium changes and maintenance of cell confluency as needed. The oligonucleotide primers used for the PCR amplification of icmT, icmV, and dotH from C. burnetii NMII genomic DNA were icmT: 5′CACCATGAAATCTCTCGATGAGG (forward) and 5′TTAGTTATCCCACCATGCTATGG (reverse), icmV: 5′CACCATGATTCTTTTGGAGTCTTCC (forward) and 5′TTATTGTTTGGACCCCTTAAAGGTG (reverse), dotH: 5′CACCATGGTGATTCGAAAAATTTTCC (forward) and 5′TTACAACCCTTCAATCATCAAC (reverse). Underlined and italicized bases, CACC and TTA, are non-C. burnetii sequences used for directional cloning and stop codon insertion, respectively. PCR products from each gene were ligated into the pET200/D-TOPO vector and transformed into E. coli TOP10 cells according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Selected clones were cultivated at 37 °C in Luria–Bertani broth containing 50 μg mL−1 kanamycin and sequence verified.